Kio estas Sulforaphane? | El Paso, TX Doktoro De Kiropractiko
D-ro. Alex Jimenez, Kiropractoro de La Paso
Mi esperas, ke vi ĝuis niajn blogajn afiŝojn pri diversaj sanaj, nutraj kaj lezaj rilataj temoj. Bonvolu ne hezitu nomi nin aŭ mi mem, se vi havas demandojn, kiam ŝprucas la bezonon de serĉado. Voku la oficejon aŭ mi mem. Oficejo 915-850-0900 - Ĉelo 915-540-8444 Grandaj Reĝoj. D-ro. J

Sulforafano estas fitoquímica, substanco ene de la grupo de organosulfuraĵoj de isotiociacanoj, trovita en krucifaj legomoj, kiel brokolo, brasiko, florbrasiko kaj Bruselo. Ĝi ankaŭ povas esti trovita en bok-choy, kale, kolardoj, mustardaj verduloj kaj akvoformoj. Esploraj studoj montris, ke sulforafano povas helpi malhelpi diversajn specojn de kancero aktivigante la produktadon de Nrf2aŭ faktoro rilatigita kun 2-nuklea faktoro, faktoro de transskribo, kiu reguligas protektajn antioksidajn mekanismojn, kiuj kontrolas la respondon de la ĉelo al oxidantoj. La celo de la sekva artikolo estas priskribi la funkcion de sulforafano.

abstrakta

La sistemo antioksidanto KEAP1-Nrf2-ARE estas ĉefa rimedo per kiu ĉeloj respondas al oxidativo kaj xenobiotaj streĉiĝoj. Sulforafano (SFN), elektrofilika izociocanato derivita de krucifaj legomoj, aktivigas la vojon KEAP1-Nrf2-ARE kaj fariĝis molekulo-intereso pri la traktado de malsanoj en kiuj kronika oxidativa streso ludas gravan etologian rolon. Ni pruvas ĉi tie, ke la mitokondria kultiva, homa retina pigmento epitelia (RPE-1) ĉeloj traktataj kun SFN spertas hiperfusion, kiu estas sendependa de ambaŭ Nrf2 kaj ĝia citoplasma inhibilo KEAP1. Mitocondrial fusion estis citita kiel cytoprotectivo per inhibo de poreformado en mitokondria dum apoptosis, kaj konsekvence kun tio, ni montras Nrf2-sendependan, citoprotekton de SFN-traktitaj ĉeloj elmontritaj al la apoptosis-inductor, staurosporina. Mekanike, SFN mildigas la reclutadon kaj / aŭ retenadon de la solvebla fisio-faktoro Drp1 al mitocondria kaj al peroxisomoj sed ne influas la ĝeneralan abundon de Drp1. Ĉi tiuj datumoj pruvas, ke la utilaj propraĵoj de SFN etendas pli tie de la aktivigo de la sistemo KEAP1-Nrf2-ARE kaj garantias plian pridemandadon donita la nunan uzon de ĉi tiu agento en multaj klinikaj provoj.

Ŝlosilvortoj: Sulforafano, Nrf2, Drp1, Mitochondria, Fission, Fusion, Apoptosis

Enkonduko

Sulforaphane estas Nrf2-Sendependa Inhibidor de Mitochondrial Fission

Sulforafano (SFN) estas izotiozana komponaĵo derivita en la dieto plej ofte de krucifaj legomoj [56]. Ĝi estas generita en plantoj kiel xenobiota respondo al predado per vesicular liberigo de la hidrolita enzimo myrosinase de damaĝitaj ĉeloj; ĉi tiu enzimo konvertas glucosinolatojn al isotiocyantes [42]. Dum la lastaj du jardekoj, SFN estis vaste karakterizita pro sia raportita kontraŭkancero, antioksidanto kaj antimicrobiaj proprietoj [57]. Multe de ĉi tiu efikeco estis atribuita al la kapablo de SFN moduli la vojon de signalo de KEAP1-antioksidanto (ARE), kvankam aldonaj agadoj de la komponaĵo estis identigitaj, inkluzive de la inhibo de la histoneco-diaksila aktiveco kaj progreso de la ĉelo-ciklo [ 2]. Nrf29 estas la maksimuma antioksidanta transskriba faktoro kaj sub kondiĉoj de homeostasis, ĝia stabileco estas subpremita per la ago de la citoplasma Cullin2KEAP3 ubiquitin ligase complex [1]. Specife, Nrf20 estas varbita al la Cullin2KEAP3-ligase per ligo al la dimeria substrato-adaptilo KEAP1 kaj poste estas modifita per poli-ĉenoj kiuj celas la transskriban faktoron por proteasome-mediated degradation. Ĉi tiu konstitua transdono limigas la duonan vivon de Nrf1 en malstreĉitaj ĉeloj al ~ 2-min [15], [30], [33], [46]. En respondo al multaj tipoj de streso, plej precipe oxidativa streso, KEAP55, ksteine-riĉa proteino, agas kiel redox-sensilo, kaj oxidativa modifo de kritikaj csteineoj, precipe C1, de KEAP151 dissocia Nrf1-KEAP2 de CUL1 tiel malhelpante Nrf3-degradadon [ 2], [8], [20]. Notinde, SFN, kaj eble aliaj aktivuloj de Nrf55, imitas oxidan streson modifante C2 de KEAP151 ekz. [1]. Stabiligo de Nrf21 permesas sian translokigon al la kerno kie ĝi induktas la esprimon de kuirilaro de Phase II antioksidanto kaj senoksokuligaj genoj. Nrf2 ligas al la antioksidaj respondaj rekompencaj elementoj (ARE) de ĝiaj kognaj celaj genoj tra heterodimerigo kun malgrandaj Maf-proteinoj [2]. Ĉi tiu sistemo prezentas dinamikan kaj sentan respondon al nerektaj antioksidantoj kiel SFN, liberaj radikaluloj generitaj de mitokondria [19] aŭ aliaj fiziologiaj fontoj de oxidativa streso [16].

Mitochondria estas dinamikaj, subcelulaj organeluloj, kiuj reguligas gastigilon de ĉelaj funkcioj, kiuj iras de ATP-produktado kaj intracelula kalcio, por redox-regulado kaj apoptosis [13], [49]. Mitocondria ankaŭ reprezentas la ĉefa fonto de reactiva oksigeno-specioj (ROS) ene de la ĉelo. Propra reguligo de mitokondria funkcio do estas necesa por optimumigi ATP-produktadon por kontentigi ĉelajn bezonojn, samtempe minimigante la eble damaĝajn efikojn de troa libera libera radikala produktado. Kritika postulo por bona modulado de mitokondria funkcio estas la kapablo por mitokondria funkcii ambaŭ sendepende kiel biokemiaj maŝinoj kaj kiel parto de vasta, respondema reto.

Mitochondria reto morfologio kaj funkcio estas determinitaj per regulado ekvilibro inter fisio kaj fandado. Mitocondrial fisio estas necesa por filia ĉela heredaĵo de mitokondria dum ĉelo-divido [28] tiel kiel por la selectiva, aŭtomata degradiĝo de senpolita aŭ damaĝita mitocondria, nomata mitopago [1]. Male, fandado estas necesa por kompletigo de mitokondriaj genomoj kaj interŝanĝo de elektronaj transportaj ĉenoj komponantoj inter najbaraj mitokondrioj [54]. Je la molekula nivelo, mitokondria fisio kaj fandado estas reguligitaj de grandaj, dinamaj similaj GTP-aĵoj. Tri enzimoj precipe reguligas fandadon: Mitofusins ​​1 kaj 2 (Mfn1 / 2) estas du-pasaj eksteraj membranaj proteinoj kiuj medias eksteran membran fandadon per heterotipaj interagoj inter apudaj mitokondrioj [15], [25], [37], dum OPA1 estas interna membrano-proteino kiu samtempe certigas matrican konektecon reguligante la mildadon de internaj membranoj [5]. La GTPase-agado de ĉiuj tri proteinoj estas postulita por fortika fandado [5], [18], kaj OPA1 estas pli reguligita per kompleksa proteólisis ene de la mitokondria interna membrano per la proteasoj OMA1 [14], PARL [6], kaj YME1L [45 ]. Grave, nerompita mitokondria membrano-potencialo estas postulita por efika fandado por subpremi la integriĝon de damaĝitaj kaj sana mitokondria [26].

Mitocondrial fission estas ĉefe katalizita per kososola proteino nomita Dynamin-rilata proteino 1 (Drp1 / DNM1L). Drp1 estas varbita de la citozo al eventualaj retejoj de fisio sur la mitokondria ekstera membrano [43]. La ĉefaj riceviloj por Drp1 sur la ekstera membrano estas mitokondria fisio-faktoro (Mff) [32] kaj, en plej malgranda mezuro, Fission 1 (Fis1) [51]. Aldone, ornamo-ricevilo, MIEF1 / MiD51, estis malkovrita, kiu agas plue limigi la aktivecon de Drp1-proteino ĉe eblaj fisio-ejoj [58]. Fojo enŝipigita ĉe la mitokondria ekstera membrano, Drp1 oligomerigas en ŝraŭblankajn strukturojn ĉirkaŭ la korpo de la mitokondriono kaj poste utiligas la energion derivita de GTP-hidrolizo por mediati la fizikan skizon de la mitokondriaj eksteraj kaj internaj membranoj [17]. La tuboluloj derivitaj de retículo endoplasmaj agas kiel komenca constrictor de mitocondria antaŭ oligomerigo de Drp1, substrekante la revelacion ke ne-konstrikta mitokondria estas pli larĝa ol la permisiva cirkvarmigo de kompleta Drip1-spiralo [12]. La dinamiko de Actin ankaŭ estas grava por la interagoj de ER-mitochondria kiu antaŭas kun fisio mitocondrial [24]. Krom lia rolo en mitokondria fisio, Drp1 katalizas la fisio de peroxisomoj [40].

Drp1 estas tre simila al la bone-karakterizita dinamina proteino, ke ambaŭ proteinoj enhavas N-finalan GTPase-domajnon, Meza domajno, kiu estas kritika por mem-oligomerigo, kaj C-fina stacio GTPase-efektiva regado [31]. Drp1 atingas selektivecon por mitokondriaj membranoj per kombinaĵo de interagoj kun ĝiaj ricevoraj proteinoj Mff kaj Fis1 kaj ankaŭ tra ĝia afineco por mitocondria-specifa fosfolipida cardiolipino tra la unika B-eniga regado de Drp1 [2]. Drp1 kutime ekzistas kiel homotetramerilo en la citoplasmo, kaj pli alta ordo en mitokondriaj fisio-ejoj estas mezurita de Meza domajno de Drp1 [3].

Donita la implicitan ligon inter mitokondria funkcio kaj la vojo KEAP1-Nrf2-ARE, ni esploris la efikojn de Nrf2-aktivigo en mitokondria strukturo kaj funkcio. Ni pruvas ĉi tie, ke SFN induktas mitokondrian hiperfusion, kiu, neatendite, estas sendependa de ambaŭ Nrf2 kaj KEAP1. Ĉi tiu efiko de SFN estas per inhibo de Drp1-funkcio. Ni plu pruvas, ke SFN donas reziston al apoptosis, kiu estas Nrf2-sendependa kaj imitaĵo, kiu observis en ĉeloj malplenigitaj de Drp1. Ĉi tiuj datumoj kolektive indikas ke krom stabiligi kaj aktivigi Nrf2, SFN modulas mitokondrian dinamikon kaj konservas ĉelan kapablon kaj postvivadon.

rezultoj

Sulforafano Induktas Nrf2 / KEAP1-Sendependa Hyperfusion de Mitochondria

Dum la studado de la efikoj de Nrf2-aktivigo pri mitokondriaj retaj dinamikoj, ni malkovris, ke traktado de senmortiĝaj homaj retina pigmento epitelia (RPE-1) ĉeloj kun sulforafano (SFN), potenca aktivigilo de Nrf2-signalo, induktis fortikan fandadon de la mitokondria reto kompare kun veturilo-traktataj kontroloĉeloj (Fig. 1A kaj B). La morfologio de la mitokondria en ĉi tiuj ĉeloj simile similis la mitokondrion en ĉeloj elĉerpitaj de siRNA de endogenaj Drp1, la ĉefa mitokondria fisio-faktoro (Fig. 1A). Ĉi tiu rezulto levis la interesan ideon ke mitokondria fisio kaj fandado-statuso respondas rekte al Nrf2-niveloj en la ĉelo. Tamen, stimulo de ĉeloj kun aliaj Nrf2-stabiligiloj kaj aktivigiloj kiel ekzemple la proteasoma inhibitoro MG132, la pro-oxidanta tBHQ, aŭ frapado de la Nrf2-inhibilo KEAP1 ne induktis mitocondrial fusion (Fig. 1A kaj B). Stabiligo de Nrf2 per ĉi tiuj manipulaĵoj estis konfirmita per okcidenta blotado por endogenaj Nrf2 (Fig. 1C). Krome, esprimo de Nrf2 estis dispensable por mitokondria fandado indikita de SFN, kiel frapado de endogenaj Nrf2 kun siRNA malsukcesis kontraŭstari ĉi tiun fenotipo (Fig. 1D-F). Pro tio ke SFN stimulas la vojon KEAP1-Nrf2-ARE per modifo covalente de restaĵoj de cistena de KEAP1 [21], ni frapis KEAP1 por trakti ĉu la SFN-induktita mitokondrial hiperfusion estas stimulita per KEAP1-dependa, sed Nrf2 sendependa vojo. Tamen, la ekspluatado de KEAP1 ankaŭ malsukcesis abrogi SFN-induktita mitocondrial fusion (Fig. 1G-I). Fakte, SFN revertis la profordan morfologion induktita de eksplodo de KEAP1 (Fig. 1G, panelo b kontraŭ panelo d). Ĉi tiuj rezultoj indikas ke la SFN-traktado kaŭzas mitokondrian fandadon sendepende de la kanona KEAP1-Nrf2-ARE-vojo kaj kondukis nin pridemandi ĉu SFN rekte efikas al komponantoj de la mitokondria fisio aŭ fandila maŝinaro.

Figuro 1 SFN indikas Nrf2 / KEAP1-sendependa mitokondria fandado. (A) RPE-1-ĉeloj estis transfectitaj kun la indikitaj siRNAs kaj 3-tagojn poste traktitaj kun DMSO aŭ la Nrf2-aktiviloj SFN (50 μM), MG132 (10 μM), aŭ tBHQ (100 μM) por 4 h. Mitocondria (ruĝa) estas etikedita kun antikorpo anti-Tom20, kaj nukleaj (bluaj) estas kontraŭkaptitaj kun DAPI. (B) Grafikaĵo montranta kvantigon de mitokondria morfologio gajnanta de (A). > 50-ĉeloj per kondiĉo estis taksitaj per blinda maniero. (C) Reprezentantaj okcidentaj blotoj de (A). (D) RPE-1-ĉeloj estis transfectitaj kun 10 nM siRNA kaj 3 tagoj poste traktitaj kun SFN por 4 h antaŭ esti fiksa kaj makulita kiel en (A). (E) Grafikaĵo montranta kvantigon de mitokondria fenotipo gajnanta de (D). > 100-ĉeloj per kondiĉo estis taksitaj per blinda maniero. (F) Reprezentantaj okcidentaj blotoj de (D). (G) Ĉeloj estis transfectitaj kaj traktataj kiel en (D) kun siCON aŭ siKEAP1. (H) Ĉeloj de (G) estis notitaj kiel en (B) kaj (E) surbaze de mitokondria morfologio. (I) Reprezentantaj okcidentaj blotoj de (G). Datumoj en (B), (E), kaj (H) estis kompilitaj de 3 sendependaj eksperimentoj ĉiu kaj statistika graveco estis difinita per du-tailed Student's t-testo. Eraroj trinkejoj reflektas +/- SD (Por interpreto de la referencoj al koloro en ĉi tiu figuro legendo, la leganto estas referita al la retejo versio de ĉi tiu artikolo).

Sulforafano difektas la mitokondrian Asocion de Drp1

Surbaze de la trovo, ke SFN-traktado induktas mitokondrian hiperfusion, ni rezonis, ke ĉi tiu fenotipo estis konsekvenco de troa fandado aŭ malhelpo de fisio-aktiveco. Por diskriminacii inter ĉi tiuj du ebloj, ni komparas la morfologion de peroxisomoj ĉe la ĉeesto kaj foresto de SFN. Peroxisomoj estas similaj al mitokondrioj, ĉar ili estas dinamikaj organoj, kies formo kaj longeco estas senĉese en fluo [44]. Peroxisomoj enhavas ambaŭ Fis1 kaj Mff en ilia ekstera membrano kaj, sekve, estas celoj por Drp1-mediated fission [22], [23]. Tamen, peroxisomoj ne uzas la fandan maŝinaron de la mitokondria reto kaj sekve, ili ne suferas fandadon [39]. Prefere, peroxisomala fisio kontraŭstaras per la plilongigo de ekzistantaj peroxisomoj per de novo aldono de membranoj kaj proteinoj [44]. Ĉar peroxisomoj malhavas de Mfn1 / 2 kaj OPA1, ni rezonis, ke se SFN aktivigas la fandan maŝinaron prefere ol malhelpi la fision-maŝinaron, la peroksoma longo ne estus tuŝita. En veturiloj-traktitaj ĉeloj, peroxisomoj estas konservitaj kiel mallongaj, rondaj, punktoformaj organeloj (Fig. 2, paneloj b kaj d). Tamen, la traktado de SFN pliigis la longitudon de peroksoma por ~ 2-fold kiel komparita kun la kontrolo de ĉeloj (Fig. 2, paneloj f kaj h). Plie, multaj el la peroxisomoj estis pinĉitaj proksime de la centro, indikante eblajn misajn difektojn (Fig. 2, panelo h, sagoj). Same, peroxisomoj en ĉeloj transfectitaj kun Drp1 siRNA estis ekstreme longaj (Fig. 2, paneloj j kaj l), konfirmante, ke Drp1 estas postulita por peroxisomala fisio kaj sugestante ke SFN-kuracado kaŭzas mitocondrial kaj peroxisomal-fenotipojn interrompante la fision-maŝinaron.

Figuro 2 SFN induktas sedksoman plilongigon. (A) RPE-1-ĉeloj estis transfectitaj kun 10 nM de la indikita siRNA kaj 3-tagojn poste traktitaj kun DMSO aŭ 50 μM SFN por 4 h. Peroxisomoj (verda) estis etikeditaj kun kontraŭ-PMP70-antikorpo, mitokondria kun MitoTracker (ruĝa), kaj DNA kontraŭstarita kun DAPI. Enlarĝitaj insetoj de peroxisomoj estas montritaj dekstre (paneloj d, h, kaj l) por faciligi la visualización de la ŝanĝoj en morfologio induktita de SFN kaj Drp1-elĉerpado. Arrowheads reliefigas constriction punktoj. (Por interpreto de la referencoj al koloro en ĉi tiu figuro legendo, la leganto estas referita al la retejo-versio de ĉi tiu artikolo).

Ni poste determinis kiel SFN limigas la funkcion Drp1. Ebloj inkluzivis reduktojn en esprimaj niveloj, reclutado / retenado ĉe mitokondria, oligomerigo aŭ enzimata agado de la GTPase. Manko de iu el ĉi tiuj rezultus reduktita mitokondria fisio kaj hiperfuzado. Ni ne detektis reprodukteblajn ŝanĝojn en Drp1-proteaj niveloj post SFN-traktado (Figs. 1C kaj 3A), kaj sekve konkludis, ke SFN ne ŝanĝas la stabilecon aŭ esprimon de Drp1, kohera kun Drp1 havanta duonvivon de> 10 h [50] kaj niaj SFN-traktadoj estas pli mallongaj. Tuj poste, ni esploris ĉu SFN influis la reclutadon aŭ retenadon de Drp1 al mitocondria. Frakciaj studoj montris, ke SFN induktis perdon de Drp1 el la mitokondria frakcio (Fig. 3A, vojoj 7-8 kaj Fig. 3B). Laŭ ĝi informis antaŭe [43], nur plej malgranda frakcio de Drp1 (~ 3%) estas asociita kun la mitokondria reto ĉe ajna tempo dum konstanta stato kondiĉoj kun plejparto de la enzimo loĝanta en la citoplasmo (Fig. 3A, vojoj 5-8). Ĉi tiuj frakciaj datumoj estis konfirmitaj per ko-lokalizo-analizo, kiu montris 40-% redukton en mitokondria-lokalizita, pledas Drp1-fokusojn post SFN-traktado (Fig. 3C kaj D). Kune, ĉi tiuj datumoj indikas ke la mitokondria fandado indikita de SFN estas, almenaŭ parte, pro la mildigita asocio de Drp1 kun la mitokondria. Niaj datumoj ne distingas inter ĉu SFN interrompas kun la mitokondria reclutado kontraŭ la mitokondria retención de Drp1, aŭ ambaŭ, ĉar la analizo de endogenaj Drp1 ne estis videbla por visualizi la GTPase per viva ĉela mikroskopio.

Figuro 3 SFN kaŭzas perdon de Drp1 el la mitokondria. (A) Subkola frakcio de RPE-1-ĉeloj sekvantaj 4 h de DMSO aŭ SFN. La frakcioj mitocondrias krudaj (Mito), citosóceas (Cyto) kaj krudaj mitocondrias (Mito) estis solvitaj de SDS-PAGE kaj ili procesis por okcidenta blotado kun la antikorpoj indikitaj. La migrado de molekulaj pezoj markiĝas maldekstre. (B) Grafikaĵoj montranta densitometria kvantigo de Drp1 en la indikitaj frakcioj de (A). (C) RPE-1-ĉeloj estis transfectitaj kun 10 nM siCON aŭ siDrp1 kaj 3 tagoj poste traktitaj kun DMSO aŭ SFN por 4 h. Drp1 (verda) estis vidigita per kontraŭ-Drp1-antikorpo, mitokondria kun MitoTracker (ruĝa), kaj kernoj kun DAPI (bluaj). (D) Aŭtomatigita ko-lokalizila analizo de Drp1 kaj MitoTracker-signalo de (C). Datumoj en (B) kaj (D) estis kompilitaj de 3 kaj 5 sendependaj eksperimentoj, respektive, kaj statistika graveco estis difinita per du-vostra studo-testo. Eraroj trinkejoj reflektas +/- SD kaj asteriskoj indikas statistikan gravecon. (Por interpreto de la referencoj al koloro en ĉi tiu figuro legendo, la leganto estas referita al la retejo-versio de ĉi tiu artikolo).

Sulforafano Atendas Protekton Kontraŭ Stapoportport-Induktita Apoptosis Sendependa de Nrf2

Antaŭa laboro montris, ke la mitokondria fisio estas permesinda en la formado de poroj en la ekstera mitokondria membrano generita de Bax / Bak dum apoptosis [11]. Drp1 montris esti selektive varbita al mitocondria dum apoptosis [11] kaj, konsekvenca kun ĉi tio, fragmentis mitocondrioj observis frue en la procezo [27]. Male, malhelpanta mitokondria fisio pensas malhelpi apoptosis blokante la formadon de la eksteraj membraj poroj kiuj permesas citokromon c liberigon [53]. Sekve, stimulanta mitokondria fandado malfruas la progreson de apoptosis induktita de komponaĵoj inkluzive de staurosporino (STS) [14]. Determini ĉu SFN protektas RPE-1-ĉelojn de STS-mediated apoptosis kaj se do, ĉu tio necesas Nrf2, ni establis provon por facile indukti poligon ADP-ribose-polimerasa (PARP), substraton de aktivigita kazpase-3 kaj fina markilo de apoptosis. Traktado de RPE-1-ĉeloj kun 1 μM STS por 6 h nur kaŭzis tre modestan diskon de PARP, sed tio estis antaŭvidita de SFN-traktado (ekz., Fig. 4A, linio 3 kontraŭ 4). Por pliigi la fortikecon de ĉi tiu analizo, ni pli sentive sentis ĉelojn al STS-induktita apoptosis per antaŭ-traktado kun siRNA celanta la kontraŭ-apoptotan faktoron, Bcl-XL. Ĉi tiu preteksto reduktis la esprimon de Bcl-XL kaj akcelis PARP-kavon kiel funkcion de tempo elmontrita al STS (Fig. 4B, komparu la linion 2 al la vojoj 4-10). Grave, 2 h antaŭ-traktado kun SFN mildigis PARP-disvastigon en ĉeloj elmontritaj al STS (Fig. 4C, linio 3 kontraŭ 4 kaj linio 5 kontraŭ 6). Same, ĉeloj stable malplenigitaj de Nrf2 per CRISPR / Cas9 estis kompare protektataj de STS toxicity per SFN-pre-traktado (Fig. 4C, linio 11 kontraŭ 12 kaj linio 13 kontraŭ 14 kaj Fig. 4D). Ĉi tiu protekto estis observita per ambaŭ PARP-divido (Fig. 4C kaj D) kaj ĉela morfologio (Fig. 4E) kiel legado. La efikeco de Nrf2-eksplodo de CRISPR / Cas9 estis konfirmita per okcidenta blotado (Fig. 4C, Nrf2-blot). Kiel antaŭvidita, elĉerpi ĉelojn de Drp1, kiu ankaŭ produktas hiperfusion-fenotipo (Fig. 1A), ankaŭ blokis PARP-dividon en respondo al STS kompare al kontroloĉeloj incubitaj kun SFN (Fig. 4F kaj G). Kune, ĉi tiuj trovoj estas konsekvencaj kun SFN-konferenca protektado kontraŭ apoptosis per ĝia kapablo restrikti la funkcion Drp1, sendepende de la stabiligo kaj aktivigo de Nrf2.

Figuro 4 La efektoj citoprotectores de SFN estas sendependaj de la esprimo de Nrf2 (A) Ĉeloj RPE-1 antaŭ-traktis kun DMSO aŭ 50 μM SFN por 2 h antaŭ traktado kun DMSO, 1 μM staurosporine (STS), aŭ 50 μM etoposide por 6 h kaj estis procesitaj por anti-PARP okcidenta blotado. (B) RPE-1-ĉeloj estis transfectitaj kun 2.5 nM siCON, 1 nM siBcl-XL, aŭ 2.5 nM siBcl-XL kaj 3 tagoj poste estis traktataj kun DMSO aŭ 1 μM STS por 2, 4 aŭ 6 h. Reprezentaj okcidentaj blotoj estas montritaj kaj la migrado de molekulaj pezoj markiĝas maldekstre. (C) CRISPR / Cas9-generita (Nrf2WT) kaj Nrf2 knockout (Nrf2KO) RPE-1-ĉeloj estis transfektaj per 1 nM siBcl-XL kaj 3 tagoj poste estis traktataj kun DMSO aŭ 50 μM SFN por 2 h. Poste, la ĉeloj estis traktitaj kun 1 μM STS por 2, 4, aŭ 6 h. Reprezentaj okcidentaj blotoj kun la indikitaj antikorpoj estas montritaj. (D) Kvanto de klara PARP kiel procento de totala PARP (klara + senkulpa) de 3 sendependaj eksperimentoj. Grave, la niveloj de klara PARP estis kompareblaj ĉu ĉeloj esprimis Nrf2 aŭ ne, indikante ke la protekto de SFN de STS estas sendependa de la transskriba faktoro. (E) 20X-kontrastaj bildoj prenitaj tuj antaŭ la rikolto de lizatoj de (C). Skalo trinkejo = 65 μm. (F) Reprezentaj okcidentaj blotoj pruvas ke eksplodo de Drp1 asignas proksime-komparebla protekto de STS kiel SFN-traktado. RPE-1-ĉeloj estis transfektaj per 1 nM siBcl-XL kaj aldone transfektitaj per 10 nM siCON aŭ 10 nM siDrp1. 3-tagojn poste, la ĉeloj de la SiCON estis antaŭprokrataj kun SFN kiel en (A) kaj (C) kaj tiam elmontritaj al STS por 4 h antaŭ esti rikoltitaj kaj procesitaj por okcidenta blotado kun la indikitaj antikorpoj. (G) Same kiel (D) por la datumoj prezentitaj en (F) kompilitaj de 3 sendependaj eksperimentoj. Eraroj trinkejoj reflektas +/- SEM

diskuto

Ni malkovris, ke SFN modulas mitokondrian fisio / fusion-dinamikon sendepende de ĝiaj efikoj en la vojo KEAP1-Nrf2-ARE. Ĉi tio estas entuziasma pro supozita ligo inter mitokondria disfuncio kaj ROS-produktado kaj la neceso de ŝvebado de mitokondriaj derivitaj liberaj radikaluloj per la aktivigo de Nrf2. Ĉi tiu plua funkcia efiko de SFN estas ebla graveco donita pli ol X-klimaj klinikaj provoj nuntempe envojaĝantaj provoj de SFN por la traktado de diversaj malsanoj, inkluzive de prostato-kancero, obstrukcia pulmonar-malsano kaj malsanĉela malsano [30], [7], [ 10].

Ĉar SFN estas izotiocanato [56] kaj ĝi aktivigas nrf2-signalon per rekte akceli kritikajn KEAP1-kestinojn por subpremi Nrf2-degradadon [21], ĝi sekvas, ke SFN praktikas ĝiajn pro-fandajn efikojn modulante la agadon de fisio aŭ fandiga faktoro per cistena modifo . Niaj datumoj forte subtenas Drp1 estante negative reguligita fare de SFN kvankam se la GTPase estas rekta celo de acilacio restas esti eluzita. Malgraŭ ĉi tiu scio, la funkcio de Drp1 estas klare kompromitata fare de SFN dum ambaŭ mitokondria kaj peroksomoj fariĝas hiperfluita En respondo al SFNa traktado kaj #? i tiu organelles dividas Drp1 por iliaj respektivaj #? efa eventoj [38]. Krome, SFN malpliigas la kvanton de Drp1 kiu lokalizas kaj amasigas ĉe mitokondria (Fig. 3). Ĉar niaj eksperimentoj estis faritaj kun ĉiuj endogenaj proteinoj, nia detección de Drp1 ĉe mitokondria fisio-ejoj estas sub konstantaj-ŝtataj kondiĉoj, kaj tial ni ne povas distingi inter reclutado kontraŭ rezervo difekto de la enzimo kaŭzita de SFN. Ni ne povas forigi la eblon, ke SFN akcepteblas ricevilo ĉe la mitokondria (Fis1 aŭ Mff) por bloki Drp1-reclutadon ankoraŭ, ni suspektas, ke Drp1 estas rekte modifita. Drp1 havas naŭ cistinojn, ok el kiuj loĝas ene de la Duona Domajno, kiu postulas oligomerigon [3], kaj unu el ili loĝas en la GTPase Effector Domain (GED) ĉe la fina stacio C de Drp1. Rekta acilacio de iu ajn el ĉi tiuj cestinoj povus kaŭzi agadon difekton en Drp1 kaj sekve submetas la efikon de SFN sur mitokondria dinamiko. Notinde, antaŭa laboro sugestas, ke difektoj en oligomerigo kaj katalizia agado povas abrogi la retenadon de Drp1 ĉe la mitokondria [52]. Cys644 en la GED-domajno estas aparte alloga celo bazita sur antaŭa laboro montranta tiun mutacion de ĉi tiu cistena fenokopioj mutacioj, kiuj malhelpas Drp1 GTPase-aktivecon [4] kaj ke ĉi tiu aparta csteino estas modifita de tiol-reactive electrophiles [9]. Rezolucio de ĉi tiu elstara demando postulos multan spektrometran validigon.In resumo, ni identigis romanon, citoprotectivan funkcion por la klinike-komparebla SFN. Krom aktivigi la majstron kontraŭ-oxidanta transskriba faktoro Nrf2, SFN promocias mitocondrial kaj peroxisomal fusion, kaj ĉi tiu efiko estas sendependa de Nrf2. La mekanismo sub ĉi tiu fenomeno implicas redukton en la funkcio de la GTPase Drp1, la primara mediatoro de mitokondrial kaj peroxisomala fisio. Grava konsekvenco de la fandado mitocondrial mediada por SFN estas kiu la ĉeloj revenas imunaj al la venenaj efektoj de la staurosporina de la apoptosis inductor. Ĉi tiu kroma ago de citoprotectora de SFN povus esti speciala klinika utileco en la multnombraj malsanoj neurodegenerativas por kiuj la aĝo estas la ĉefa faktoro de risko (ekzemple, la Malsano de Parkinson, la Malsano de Alzheimer, la degeneración macular de la aĝo) pro tio ke ĉi tiuj maladies asociis kun apoptosis kaj reduktita niveloj kaj / aŭ disregulado de Nrf2 [35], [36], [48]. Kune, ĉi tiuj datumoj pruvas, ke la citoprotectivaj propraĵoj de SFN etendas pli tie de aktivigo de la sistemo KEAP1-Nrf2-ARE kaj garantias pliajn studojn donitajn la nunan uzon de ĉi tiu agento en multaj klinikaj provoj.

Materialoj kaj Metodoj

Apoptosisaj Atestoj

Ĉeloj estis semitaj kaj transfektaj per siRNA kiel indikis sube. La ĉeloj estis antaŭ-traktita kun 50 μM sulforaphane por 2 h por indukti mitokondrian fandadon kaj tiam estis traktitaj kun 1 μM staurosporine por indukti apoptosis. En la tempo de rikolto, amaskomunikiloj estis kolektitaj en individuaj tuboj kaj submetitaj al alta rapida centrifugado al pilataj apoptotaj ĉeloj. Ĉi tiu ĉelo pelleto estis kombinita kun adheraj ĉeloj kaj solviligita en 2-koncentrita Laemmli-bufro. Specimenoj estis submetitaj al anti-PARP okcidenta blotado.

CRISPR / Cas9 Konstrua Generacio

Por krei LentiCRISPR / eCas9 1.1, LentiCRISPR v2 (addgeno #52961) unue estis tranĉita kun Age1 kaj BamH1. Poste, SpCas9 el eSpCas9 1.1 (addgene #71814) estis PCR amplifita per Age1 kaj BamH1 overhangs uzante la sekvajn primerojn (Antaŭen AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Reverse AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) kaj ligita en la tranĉita vektoro supre. La sekvoj de sgRNA estis determinitaj per Benchling.com. Parametroj fiksis celi la kodigan sekvencon kun la plej altaj sur-celo kaj plej malaltaj sen-celo-punktoj. La jenaj sekvencoj (celado sinsekvo substrekitan, HS sgNFE2L2 # 1 senco CACCGCGACGGAAAGAGTATGAGC, antisense AAACGCTCATACTCTTTCCGTCGC; hs sgNFE2L2 # 2 senco CACCGGTTTCTGACTGGATGTGCT, antisense AAACAGCACATCCAGTCAGAAACC; hs sgNFE2L2 # 3 senco CACCGGAGTAGTTGGCAGATCCAC, antisense AAACGTGGATCTGCCAACTACTCC) estis recocidos kaj ligated en BsmB1 tranĉis LentiCRISPR / eCas9 1.1. Lentivirally infektitaj RPE-1-ĉeloj estis selektitaj per puromikino kaj konservitaj kiel populara ĉelo. Knockout estis konfirmita per immunofluorescence kaj okcidenta blotado.

Ĉela Kulturo kaj Transfekcioj

Homaj retinaj epiteliaj ĉeloj transformitaj per telomerasa (RPE-1) (ATCC) estis kultitaj en Dulbecco's Modified Eagle Medium (DMEM) enhavanta 1 g / L-glucoseon suplementitan per penicilino, streptomikino, 1X ne-esenca aminoaktika koktelo (Life Technologies), Kaj 10% Fetala Bova Serumo (Viva Teknologioj). Por siRNA-transfekcioj, 30,000-35,000-ĉeloj / ml estis semitaj dum la tuta nokto. Ĉeloj ricevis 10 nM-siRNA diluitajn en serum-senpaga DMEM kaj kombinitaj kun 0.3-% Interferin-transfekta reagento (PolyPlus). Por apoptosis-sentiveco, ĉeloj ricevis 1 nM Bcl-XL-siRNA. Ĉeloj estis rikoltitaj 2-3-tagoj post-transfekcio.

Kemiaĵoj, Antikorpoj, kaj siRNA-Oligoj

Antikorpoj kontraŭ α-tubulino (Ĉela signalo), β-tubulino (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Cell Signaling), PMP70 (Abcam), kaj Tom20 (BD Biosciences ) estis uzataj ĉe 1: 1000-diluoj por okcidenta blotado kaj por immunofluoresko. En-domo, anti-Nrf2 kuniklo antikorpo uzis 1: 2000 por okcidenta blotting [34], [59]. Sulforafano (Sigma) kaj staurosporina (Tocris) estis uzataj ĉe 50 μM kaj 1 μM respektive. SeRNAs kontraŭ Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Cell Signaling), kaj Bcl-XL (Cell Signaling) estis uzataj ĉe 10 nM krom se alie rimarkis.

Immunofluorescence kaj en Vivo Labeling

Ĉeloj semitaj sur 18-mm-vitro-kovriloj estis traktataj per veturilo aŭ drogo, fiksitaj en 3.7-formaladehido kaj tiam permeabiligitaj en 0.2% Tritono X-100 / PBS sur glacio por 10-min. Primaj antikorpoj estis kovitaj en 3-bovina serumalbumino (BSA) en PBS dum la nokto dum 4 ° C. Sekvante PBS-lavegojn, ĉeloj estis inkubataj por 1 h en specioj taŭgaj, Alexa488- aŭ Alexa546-, malĉefaj antikorpoj konjugaciitaj (diluitaj 1: 1000) kaj 0.1 μg / mL DAPI (Sigma) en 3% BSA / PBS. Mitochondria estis vidigita per anti-Tom20 immunofluorescence aŭ per incubado de ĉeloj en 200 nM MitoTracker Ruĝa CMXRos (Molecular Probes, Inc.) en serum-senpaga DMEM por 30-min ĉe 37 ° C antaŭ ripari.

Mikroskopio kaj Bilda Analizo

Imunofluoreskaj specimenoj estis viditaj per LSM710-Konfoka mikroskopo (Carl Zeiss). Micrografoj estis kaptitaj per 63X aŭ 100X-oraj mergaj objektivoj kaj bildoj ĝustigitaj kaj plibonigitaj uzante Adobe Photoshop CS6. Co-lokaliga analizo estis farita per Carl Zeiss LSM710-ko-lokaliga trajto kun sojloj permane agorditaj dum blinde al la identeco de la specimenoj. Skalaj trinkejoj ĝenerale, krom se alie indikas, estas 10 μm. Mitochondrial morfologio estis taksita per blindita poentado. Se la mitokondria de ĉelo estis subtenita kiel multnombraj, rondaj, diskriminaciaj punktoj, la ĉelo estis notita kiel 'fisio'. Se individuaj mitokondroj estis indistinguaj kaj la tuta mitokondria reto aperis kontinua, la ĉelo estis notita kiel "fandado". Ĉiuj aliaj ĉeloj, inkluzive de tiuj kun amasigo de mitokondrioj, estis notitaj kiel "interaj".

Frakcioj subcelulares

RPE-1-ĉeloj kreskis al konfluo. Post la lavado de PBS, la ĉeloj estis submetitaj al centrifugado ĉe 600 × g por 10-min kaj resuspenditaj en 600 μL izolado buffer (210 mM Mannitol, 70 mM Sucrose, 5 mM MOPS, 1 mM EDTA pH 7.4 + 1 mM PMSF). La pendado estis lysed 30-tempoj en Dounce-homogeniganto. Frakcio de la homogenato estis konservita kiel "tuta ĉelo-lizato". La resto estis submetita al centrifugado ĉe 800 × g por 10-min por pellet-kernoj. Supernatantoj estis submetitaj al centrifugado ĉe 1500 × g por 10-min por liberigi ceterajn kernojn kaj neflankajn ĉelojn. Ĉi tiu supernatoro estis submetita al centrifugado ĉe 15,000 × g por 15-min por pellet mitocondria. La supernativulo estis konservita kiel la "katosola frakcio". La pelleto estis lavita milde kun PBS kaj resuspendita en izolata bufro. La proteino-koncentriĝo de ĉiu frakcio estis mezurita per bicinchoninic acid (BCA)-provizo kaj ekvivalentaj kvantoj de proteino estis solvitaj per SDS-PAGE.

Okcidenta Blotado

La ĉeloj estis lavitaj en PBS kaj solubiligitaj en 2-fojoj koncentris la solvon de solvo de Laemmli (100 mM Tris [pH 6.8], 2% SDS, 0.008% bromophenol blua, 2% 2-mercaptoethanol, 26.3-glicerolo, kaj 0.001% Pirinino Kaj). Lizatoj estis bolitaj por 5-mino antaŭ ŝarĝi en sodio dodecil-sulfato (SDS) poliacrilamaj geeloj. La proteinoj estis transferidas al membranoj de nitrocelulosa kaj la membranoj estis blokitaj por 1 h en 5% Milk / TBST. Primaj antikorpoj diluis en 5% Milk / TBST kaj incubadis per la forigo dum 4 ° C dum la nokto. La malĉefaj antikorpoj conjugataj per benzino (HRP) estis diluitaj en 5% Milk / TBST. Blotoj estis procesitaj per plibonigita kvarmuminesko kaj densitometraj kvantoj estis faritaj per ImageJ-softvaro.

D-ro Jimenez Blanka Ŝildo

Sulforafano estas kemiaĵo de la izotiocianata kolekto de organosulfuraj substancoj akiritaj de krucifaj legomoj, inkluzive de brokolo, brasiko, florbrasiko, kaleo, kaj kolonoj, inter aliaj. Sulforafano estas produktita kiam la enzimo myrosinasa transformas glucoraphanin, glucosinolata, en sulforafano, ankaŭ sulforafane-glucosinolatan. Brokolaj brutoj kaj florbrasiko havas la plej altan koncentriĝon de glucorapano aŭ la antaŭulo al sulforafano. Studoj de esploro pruvis, ke sulforafano plifortigas la antioksidajn kapablojn de la homa korpo por eviti diversajn sanajn aferojn.

D-ro Alex Jimenez DC, CCST Insight

Sulforafano kaj Efektoj pri Kancero, Morteco, Aĝo, Cerbo kaj Konduto, Kora Malsano & Pli

Isotiocyanates estas kelkaj el la plej gravaj plantaj komponaĵoj kiujn vi povas akiri en via dieto. En tio ĉi video Mi faras la plej ampleksan kazon por tiuj, kiuj iam fariĝis. Mallonga atento span? Reiru al via plej ŝatata temo klakante unu el la tempoj sube. Plena timeline sube.

Ŝlosilaj sekcioj:

  • 00: 01: 14 - Kancero kaj morteco
  • 00: 19: 04 - Envejecimiento
  • 00: 26: 30 - Cerbo kaj konduto
  • 00: 38: 06 - Rekomenca fino
  • 00: 40: 27 - Dozo

Plena templinio:

  • 00: 00: 34 - Enkonduko de sulforafano, grava fokuso de la video.
  • 00: 01: 14 - Crucifera vegeta konsumo kaj reduktoj en ĉiuj kaŭzoj de morteco.
  • 00: 02: 12 - Prostato kancero risko.
  • 00: 02: 23 - Vigla kancero risko.
  • 00: 02: 34 - Pulmo kancero en fumantoj risko.
  • 00: 02: 48 - Mastra kancero risko.
  • 00: 03: 13 - Hipotetika: kio se vi jam havas kanceron? (interventicia)
  • 00: 03: 35 - Plausible mekanismo veturanta la kancero kaj morteco asocieca datumo.
  • 00: 04: 38 - Sulforafano kaj kancero.
  • 00: 05: 32 - Besto montranta fortan Efekto de brokolo ŝprucas ekstrakton sur vespera tumoro-disvolviĝo en ratoj.
  • 00: 06: 06 - Efekto de rekta suplemento de sulforafano en prostaj kancero-pacientoj.
  • 00: 07: 09 - Biokumulado de isociocianaj metabolitoj en reala brusta ŝtofo.
  • 00: 08: 32 - Malhelpo de mamora kancero.
  • 00: 08: 53 - Historio-leciono: brassikoj estis establitaj kiel havantaj sanajn proprietojn eĉ en antikva Romo.
  • 00: 09: 16 - Sulforafano kapablo plibonigi karcinogenan ekskrecion (benzeno, acroleino).
  • 00: 09: 51 - NRF2 kiel genetika ŝaltilo per antioksidaj respondaj elementoj.
  • 00: 10: 10 - Kiel NRF2-aktivigo plibonigas karcinogenan ekskrecion per glutatione-S-konjugacioj.
  • 00: 10: 34 - Bruselo-bruskoj pliigas glutation-S-transferanon kaj reduktas damaĝojn de ADN.
  • 00: 11: 20 - Brokolo ŝprucas trinkaĵon pliigas benzene-ekskrecion per 61%.
  • 00: 13: 31 - Brokolo ŝprucas homogenate pliigas enzimojn antioksidanto en la supra aviadilo.
  • 00: 15: 45 - Crucifera vegeta konsumo kaj kora malsano morteco.
  • 00: 16: 55 - Brokoli ŝprucaĵo de polvo plibonigas sangajn lipidojn kaj ĝenerale koraksan riskon en tipo 2-diabetiko.
  • 00: 19: 04 - Komenco de envejeci sekcio.
  • 00: 19: 21 - Sulforafano-riĉigita dieto plibonigas vivdaŭro de skaraboj de 15 al 30% (en certaj kondiĉoj).
  • 00: 20: 34 - Graveco de malalta inflamo por longeviveco.
  • 00: 22: 05 - Cruciferaj legomoj kaj brokolo ŝprucas pulvoron ŝajnas redukti ampleksan varion da inflamaj markiloj en homoj.
  • 00: 23: 40 - Meza-video recap: kancero, maljuniĝaj sekcioj
  • 00: 24: 14 - Musaj studoj sugestas ke sulforafano povus plibonigi adaptan imunan funkcion en maljuneco.
  • 00: 25: 18 - Sulforafano plibonigita hara kresko en musa modelo de kalvaĵo. bildo ĉe 00: 26: 10.
  • 00: 26: 30 - Komenco de cerbo kaj konduto sekcio.
  • 00: 27: 18 - Efekto de brokolo ŝprucas ekstrakton sur aŭtismo.
  • 00: 27: 48 - Efekto de glucoraphanin sur skizofrenio.
  • 00: 28: 17 - Komenco de depresio diskuto (plausible mekanismo kaj studoj).
  • 00: 31: 21 - Muso studas uzante 10 malsamajn modelojn de stres-induktita depresio montras sulforafano simile efika kiel fluoxetina (prozak).
  • 00: 32: 00 - Studoj montras rektan ingestion de glucoraphanin en musoj simile efika antaŭ la malhelpo de depresio de socia malvenko-streso-modelo.
  • 00: 33: 01 - Komenco de neurodegenera sekcio.
  • 00: 33: 30 - Sulforafano kaj Alzheimer-malsano.
  • 00: 33: 44 - Sulforafano kaj Parkinson-malsano.
  • 00: 33: 51 - Sulforafano kaj malsato de Hungtington.
  • 00: 34: 13 - Sulforafano pliigas varmegonŝokajn proteinojn.
  • 00: 34: 43 - Komenco de traŭmata cerbo-sekcio.
  • 00: 35: 01 - Sulforafano injektita tuj post kiam TBI plibonigas memoron (musa studo).
  • 00: 35: 55 - Sulforafano kaj neŭtraleco.
  • 00: 36: 32 - Sulforafano plibonigas lernadon modelo De tipo II diabeto en musoj.
  • 00: 37: 19 - Sulforafano kaj duchenne distrofia muskola
  • 00: 37: 44 - Mitatina inhibo en muskolaj satelitoj (in vitro).
  • 00: 38: 06 - Recapitulación de malfrua video: morteco kaj kancero, damaĝo de ADN, streĉiĝo oxidativa kaj inflamo, excreción de benzeno, malsano cardiovascular, diabeto tipo 2a, efektoj en la cerbo (depresio, aŭto, skizofrenio, neurodegeneración), aŭtoveturejo NRF2.
  • 00: 40: 27 - Pensoj pri elmontrado de dozo da brokoloj aŭ sulforafano.
  • 00: 41: 01 - Anekdotoj sur ŝvelado hejme.
  • 00: 43: 14 - Sur kuirej temperaturoj kaj sulforafana aktiveco.
  • 00: 43: 45 - Kutima konvertiĝo de bakterioj de sulforafano de glucorapano.
  • 00: 44: 24 - Suplementoj funkcias pli bone kiam kombinitaj kun aktiva myrosinase de legomoj.
  • 00: 44: 56 - Kuirejaj teknikoj kaj krucifaj legomoj.
  • 00: 46: 06 - Isotiocianoj kiel goitrogensoj.

Dankoj

Sciencedirect.com/science/article/pii/S2213231716302750

Kiel estas Sulforaphane Produktita?

Heating Reduktas Epitiospecifier Protein Activity kaj Pliigas Sulforaphane Formation in Broccoli

abstrakta

Sulforafano, isotiocianato de brokolo, estas unu el la plej potencaj manĝaĵoj derivitaj de antikarkinogenoj. Ĉi tiu komponaĵo ne ĉeestas en la nerompita legomo, pli ĝuste ĝi estas formita de ĝia glucosinola pioniro, glucoraphanin, per la ago de myrosinase, tioglucosidasa enzimo, kiam brokolo-ŝtofo estas disbatita aŭ maĉita. Tamen, kelkaj studoj pruvis, ke sulforafena rendimento de glucorapano estas malalta, kaj ke ne-bioactive nitrilo analoga, sulforaphane nitrilo, estas la primara hidrolizo produkto kiam planto histo estas disbatita ĉe ĉambro temperaturo. Freŝa evidenteco sugestas, ke en Arabidopsis, nitrila formado de glucosinolatoj estas kontrolita per varmema proteino, epitiospecifier proteino (ESP), ne-kataliza cofaktoro de myrosinase. Niaj objektivoj estis ekzameni la efikojn de hejtado de brokoloj kaj brutoj sur sulforafano kaj sulforafana nitrila formado, por determini ĉu brokolo enhavas aktivecon de ESP, por korekti varmegajn ŝanĝojn en la aktiveco de ESP, enhavo de sulforafano kaj bioaktiveco, kiel mezurita per indukto de la fazo II-detoxificación enzimo quinone reductase (QR) en ĉela kulturo. Varmiganta freŝajn brokolajn floretojn aŭ brokolajn ŝprucojn al 60 ° C antaŭ ol homogeneigo samtempe pliigis sulforafane formadon kaj malpliigis sulforafana nitrila formado. Grava perdo de ESP-aktiveco parolis la malpliigon de sulforafana nitrila formado. La varmego al 70 ° C kaj pli supre malpliigis la formadon de ambaŭ produktoj en brokoli floretoj, sed ne en brokolo-ŝuoj. La indukto de QR en klera muso hepatoma Hepa lclc7 ĉeloj paralele pliigas en sulforafena formado.

Pre-hejtado de brokolo floroj kaj ŝraŭboj al 60 ° C signife pliigis la myrosinase-kataligitan formadon de sulforafano (SF) en vegetalaj ŝtofoj eltiraĵoj post disbatado. Ĉi tio estis asociita kun malpliigoj en formado de sulforafana nitrilo (SF Nitrile) kaj epitiospecifier protein (ESP)-agado.

Ŝlosilvortoj: Brokolo, Brassica oleracea, Cruciferae, Kancero, Anticarcinogeno, Sulforafano, Sulforafana nitrilo, Epitiopecifier-proteino, Quinone-reductase

En konkludo, sulforafano estas fitoĥema trovita en brokolo,kaj aliaj krucifaj legomoj. Nekontrolita kvanto da oxidantoj kaŭzitaj de ambaŭ internaj kaj eksteraj faktoroj povas kaŭzi oxidan streson en la homa korpo, kiu finfine kondukas al diversaj sanaj problemoj. Sulforafano povas aktivigi la produktadon de Nrf2, faktoro de transskribo kiu helpas reguligi protektajn antioksidajn mekanismojn kiuj kontrolas la respondon de la ĉelo al oxidantoj. La amplekso de nia informo estas limigita al kiropractiko kaj spinalesaj aferoj. Por diskuti la aferon, bonvolu peti D-ro Jimenez aŭ kontakti nin ĉe 915-850-0900 .

Kuraĝita de doktoro Alex Jimenez

Referencita de: Sciencedirect.com

Poŝtelefono Voku Nun Butonon H .png

Pliaj Temo Diskuto: Akra Malantaŭa Doloro

Malantaŭa doloro Estas unu el la plej kutimaj kaŭzoj de malkapablo kaj malĝojataj tagoj en la mondo. Malantaŭa doloro atribuas la duan plej oftan kialon por kuracaj oficejaj vizitoj, pli nombrata nur per supraj spiraj infektoj. Proksimume 80 procento de la loĝantaro spertos malantaŭan doloron almenaŭ unufoje dum sia vivo. La spino estas kompleksa strukturo formita de ostoj, artikoj, ligamentoj kaj muskoloj, inter aliaj molaj ŝtofoj. Pro ĉi tio, vundoj kaj / aŭ difektitaj kondiĉoj, kiel ekzemple hernaj diskoj, povas eventuale konduki al simptomoj de malantaŭa doloro. Sportaj vundoj aŭ aŭtoveturejaj vundoj estas ofte la plej ofta kaŭzo de malantaŭa doloro, tamen, kelkfoje la plej simpla movado povas havi dolorajn rezultojn. Feliĉe, alternativaj traktadoj, kiel ekzemple kiropractika zorgo, povas helpi al reteni dolorecon per la uzo de verteblaj ĝustigoj kaj manlibroj, finfine pliboniganta dolorajn reliefojn.

blogbildo de karikatura knabo

EXTRA EXTRA | GRAVA TEMO: Rekomendita El Paso, TX Chiropractor

***